Review



anti gfap  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Cell Signaling Technology Inc anti gfap
    Effects of exosomes derived from GABA-fed mice on hippocampus in aged mice. ( a ) Brain sections (dentate gyrus, DG) were incubated with primary antibody for anti-Iba1, <t>anti-GFAP,</t> anti-p21 and anti-β-galactosidase, and stained with Alexa Fluor 555. After staining with Vestashield mounting medium, the tissue samples were observed under a fluorescence microscope. A 50 μm scale bar is shown in the lower right corner of each photograph. ( b ) Number of Iba1 + cells per area and relative area of GFAP + cells, p21 + cells and SA-β-Gal + cells in DG, CA3 and CA1 are shown as bar graphs (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. Adult mice; # p < 0.05; ## p < 0.01; ### p < 0.001 vs. Aged (Ctrl-Exo) mice; data are represented as means ± SEM, n = 10). GABA: Gamma-aminobutyric acid.
    Anti Gfap, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 414 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/80788s/GFAP+XP+Rabbit+mAb/pmc13026798-171-16-18
    Average 96 stars, based on 414 article reviews
    anti gfap - by Bioz Stars, 2026-09
    96/100 stars

    Images

    1) Product Images from "GABA-Induced Exosomes Improve Memory Impairment in Aged Mice"

    Article Title: GABA-Induced Exosomes Improve Memory Impairment in Aged Mice

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms27062519

    Effects of exosomes derived from GABA-fed mice on hippocampus in aged mice. ( a ) Brain sections (dentate gyrus, DG) were incubated with primary antibody for anti-Iba1, anti-GFAP, anti-p21 and anti-β-galactosidase, and stained with Alexa Fluor 555. After staining with Vestashield mounting medium, the tissue samples were observed under a fluorescence microscope. A 50 μm scale bar is shown in the lower right corner of each photograph. ( b ) Number of Iba1 + cells per area and relative area of GFAP + cells, p21 + cells and SA-β-Gal + cells in DG, CA3 and CA1 are shown as bar graphs (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. Adult mice; # p < 0.05; ## p < 0.01; ### p < 0.001 vs. Aged (Ctrl-Exo) mice; data are represented as means ± SEM, n = 10). GABA: Gamma-aminobutyric acid.
    Figure Legend Snippet: Effects of exosomes derived from GABA-fed mice on hippocampus in aged mice. ( a ) Brain sections (dentate gyrus, DG) were incubated with primary antibody for anti-Iba1, anti-GFAP, anti-p21 and anti-β-galactosidase, and stained with Alexa Fluor 555. After staining with Vestashield mounting medium, the tissue samples were observed under a fluorescence microscope. A 50 μm scale bar is shown in the lower right corner of each photograph. ( b ) Number of Iba1 + cells per area and relative area of GFAP + cells, p21 + cells and SA-β-Gal + cells in DG, CA3 and CA1 are shown as bar graphs (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. Adult mice; # p < 0.05; ## p < 0.01; ### p < 0.001 vs. Aged (Ctrl-Exo) mice; data are represented as means ± SEM, n = 10). GABA: Gamma-aminobutyric acid.

    Techniques Used: Derivative Assay, Incubation, Staining, Fluorescence, Microscopy

    Related Articles

    other:

    Article Title: TMEM251 loss-induced autophagy dysfunction in the anterior cingulate cortex contributes to chronic postoperative pain
    Article Snippet: Rabbit anti-GFAP , Cell Signaling Technology , Cat# 80788S.

    Recombinant:

    Article Title: NGPF2 triggers synaptic scaling up through ALK-LIMK-cofilin-mediated mechanisms.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse GluA2-NTD Millipore Cat#MAB397; RRID: AB_2113875 Rabbit NGPF2 Peprotech Cat#500-P171; RRID: AB_148164 Rabbit NGPF1 Proteintech Cat# 10821-1-AP, RRID: AB_11042879 Rabbit Cofilin CST Cat#5175; RRID: AB_10622000 Rabbit p-Cofilin Santa Cruz Cat#sc-12912-R; RRID: AB_673572 Rabbit p-LIMK1/p-LIMK2 Origene Cat#TA325621S Rabbit MAP2 Millipore Cat#MAB3418; RRID: AB_11212326 Rabbit FMRP CST Cat#4317S; RRID: AB_1903978 Rabbit Synapsin 1 CST Cat# 5297, RRID: AB_2616578 Rabbit ALK Abcam Cat#ab275964 Rabbit GFAP CST Cat80788S; RRID: AB_2799963 Rabbit NeuN Abcam Cat#ab177487; RRID: AB_2532109 Rabbit Actin Bioworld Cat#ap0060; RRID: AB_2797445 Rabbit LIMK1 CST Cat#3842S; RRID: AB_2281332 Rabbit ALDH1L1 Abcam Cat#ab177463; RRID: AB_2811300 Rabbit GluA1 CST Cat#13185; RRID: AB_2732897 Mouse beta-3-Tubulin CST Cat# 4466; RRID: AB_1904176 Rabbit p-ERK CST Cat# 4370; RRID: AB_2315112 Rabbit p-Akt (Ser473) CST Cat# 4060; RRID: AB_2315049 Rabbit p-Akt (Thr308) CST Cat# 13038, RRID: AB_2629447 Chemicals, peptides, and recombinant proteins Tetrodotoxin Alomone Labs Cat#T-550 Picrotoxin Sigma-Aldrich Cat#R284556 Bicuculline Sigma-Aldrich Cat#B7561 LDK Selleck Cat#S7083 ASP Selleck Cat#S8054 LIMKi-3 Sigma-Aldrich Cat#435930 Rhodamine Phalloidin Thermo-Fisher Cat#R415 DAPI Cayman Chemical Cat#28718-90-3 Poly-D-Lysine Sigma-Aldrich Cat#P7280 Diamond Antifade Mountant Thermo-Fisher Cat#P36965 GlutaMax Thermo-Fisher Cat#35050061 Neurobasal A Thermo-Fisher Cat#10888022 B27 Thermo-Fisher Cat#17504044 Penicillin-Streptomycin GIBCO Cat#15140122 Actinomycin D Selleck Cat#S8964 Anisomycin Selleck Cat#S7409 rNGPF2 protein This paper N/A Deposited data scRNA-Seq Data Bhattacherjee et al., 2019 GEO: GSE124952 scRNA-Seq Data Chu et al., 2019 GEO: GSE135326 RNA-seq Data This paper GEO:GSE179402 (Continued on next page) e1 Cell Reports 36, 109515, August 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines CHO cells SIBCB GNHa 7 Experimental models: organisms/strains C57BL/6 wildtype mice Charles River N/A LIMK1/2 double knockout mice Meng et al., 2002; Takahashi et al., 2002 N/A B6.129P2-Fmr1tm1Cgr/J Jackson Laboratory JAX: 003025 Oligonucleotides ASO1: GCTTAGTCACGCGGATGGTC This paper N/A ASO2: CTTGTATTTGCAGTCGGCTC This paper N/A ASO3: AAGGGCGAGAAGGAAGAAGC This paper N/A Recombinant DNA NGPF2/pIRES2-EGFP This paper N/A Software and algorithms pCLAMP 11 Molecular Device https://www.moleculardevices.com/ Mini Analysis Program 6.0.3 Synaptosoft Inc http://www.synaptosoft.com/ Zen 2010 software Zeiss https://www.zeiss.com/microscopy/ int/home.html ImageJ NIH https://imagej.nih.gov/ij/index.html

    RNA Sequencing:

    Article Title: NGPF2 triggers synaptic scaling up through ALK-LIMK-cofilin-mediated mechanisms.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse GluA2-NTD Millipore Cat#MAB397; RRID: AB_2113875 Rabbit NGPF2 Peprotech Cat#500-P171; RRID: AB_148164 Rabbit NGPF1 Proteintech Cat# 10821-1-AP, RRID: AB_11042879 Rabbit Cofilin CST Cat#5175; RRID: AB_10622000 Rabbit p-Cofilin Santa Cruz Cat#sc-12912-R; RRID: AB_673572 Rabbit p-LIMK1/p-LIMK2 Origene Cat#TA325621S Rabbit MAP2 Millipore Cat#MAB3418; RRID: AB_11212326 Rabbit FMRP CST Cat#4317S; RRID: AB_1903978 Rabbit Synapsin 1 CST Cat# 5297, RRID: AB_2616578 Rabbit ALK Abcam Cat#ab275964 Rabbit GFAP CST Cat80788S; RRID: AB_2799963 Rabbit NeuN Abcam Cat#ab177487; RRID: AB_2532109 Rabbit Actin Bioworld Cat#ap0060; RRID: AB_2797445 Rabbit LIMK1 CST Cat#3842S; RRID: AB_2281332 Rabbit ALDH1L1 Abcam Cat#ab177463; RRID: AB_2811300 Rabbit GluA1 CST Cat#13185; RRID: AB_2732897 Mouse beta-3-Tubulin CST Cat# 4466; RRID: AB_1904176 Rabbit p-ERK CST Cat# 4370; RRID: AB_2315112 Rabbit p-Akt (Ser473) CST Cat# 4060; RRID: AB_2315049 Rabbit p-Akt (Thr308) CST Cat# 13038, RRID: AB_2629447 Chemicals, peptides, and recombinant proteins Tetrodotoxin Alomone Labs Cat#T-550 Picrotoxin Sigma-Aldrich Cat#R284556 Bicuculline Sigma-Aldrich Cat#B7561 LDK Selleck Cat#S7083 ASP Selleck Cat#S8054 LIMKi-3 Sigma-Aldrich Cat#435930 Rhodamine Phalloidin Thermo-Fisher Cat#R415 DAPI Cayman Chemical Cat#28718-90-3 Poly-D-Lysine Sigma-Aldrich Cat#P7280 Diamond Antifade Mountant Thermo-Fisher Cat#P36965 GlutaMax Thermo-Fisher Cat#35050061 Neurobasal A Thermo-Fisher Cat#10888022 B27 Thermo-Fisher Cat#17504044 Penicillin-Streptomycin GIBCO Cat#15140122 Actinomycin D Selleck Cat#S8964 Anisomycin Selleck Cat#S7409 rNGPF2 protein This paper N/A Deposited data scRNA-Seq Data Bhattacherjee et al., 2019 GEO: GSE124952 scRNA-Seq Data Chu et al., 2019 GEO: GSE135326 RNA-seq Data This paper GEO:GSE179402 (Continued on next page) e1 Cell Reports 36, 109515, August 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines CHO cells SIBCB GNHa 7 Experimental models: organisms/strains C57BL/6 wildtype mice Charles River N/A LIMK1/2 double knockout mice Meng et al., 2002; Takahashi et al., 2002 N/A B6.129P2-Fmr1tm1Cgr/J Jackson Laboratory JAX: 003025 Oligonucleotides ASO1: GCTTAGTCACGCGGATGGTC This paper N/A ASO2: CTTGTATTTGCAGTCGGCTC This paper N/A ASO3: AAGGGCGAGAAGGAAGAAGC This paper N/A Recombinant DNA NGPF2/pIRES2-EGFP This paper N/A Software and algorithms pCLAMP 11 Molecular Device https://www.moleculardevices.com/ Mini Analysis Program 6.0.3 Synaptosoft Inc http://www.synaptosoft.com/ Zen 2010 software Zeiss https://www.zeiss.com/microscopy/ int/home.html ImageJ NIH https://imagej.nih.gov/ij/index.html



    Similar Products

    96
    Cell Signaling Technology Inc anti gfap
    Effects of exosomes derived from GABA-fed mice on hippocampus in aged mice. ( a ) Brain sections (dentate gyrus, DG) were incubated with primary antibody for anti-Iba1, <t>anti-GFAP,</t> anti-p21 and anti-β-galactosidase, and stained with Alexa Fluor 555. After staining with Vestashield mounting medium, the tissue samples were observed under a fluorescence microscope. A 50 μm scale bar is shown in the lower right corner of each photograph. ( b ) Number of Iba1 + cells per area and relative area of GFAP + cells, p21 + cells and SA-β-Gal + cells in DG, CA3 and CA1 are shown as bar graphs (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. Adult mice; # p < 0.05; ## p < 0.01; ### p < 0.001 vs. Aged (Ctrl-Exo) mice; data are represented as means ± SEM, n = 10). GABA: Gamma-aminobutyric acid.
    Anti Gfap, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/80788s/GFAP+XP+Rabbit+mAb/pmc13026798-171-16-18
    Average 96 stars, based on 1 article reviews
    anti gfap - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc gfap
    Effects of exosomes derived from GABA-fed mice on hippocampus in aged mice. ( a ) Brain sections (dentate gyrus, DG) were incubated with primary antibody for anti-Iba1, <t>anti-GFAP,</t> anti-p21 and anti-β-galactosidase, and stained with Alexa Fluor 555. After staining with Vestashield mounting medium, the tissue samples were observed under a fluorescence microscope. A 50 μm scale bar is shown in the lower right corner of each photograph. ( b ) Number of Iba1 + cells per area and relative area of GFAP + cells, p21 + cells and SA-β-Gal + cells in DG, CA3 and CA1 are shown as bar graphs (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. Adult mice; # p < 0.05; ## p < 0.01; ### p < 0.001 vs. Aged (Ctrl-Exo) mice; data are represented as means ± SEM, n = 10). GABA: Gamma-aminobutyric acid.
    Gfap, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/80788s/GFAP+XP+Rabbit+mAb/pm41772141-92-59-61
    Average 96 stars, based on 1 article reviews
    gfap - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc glial fibrillary acidic protein gfap antibody
    The BBB-reversible opening effects by Au-rGO in vivo . (A) Schematic representation of Au-rGO exposure and the Evans blue permeability test in vivo . (B) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at different doses. (C) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at a dose of 4 mg/kg body weight for various durations ( n = 3). (D) Vibratome sections of brain tissue stained with horseradish peroxidase from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for different time points ranging from 30 min to 7 days. (E) Immunoblot analysis of VE-cadherin and Claudin-5 in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (F) Top-to-bottom continuous brain sections from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 2 h. (G) Measurement of Au content as an indicator of Au-rGO retention in brain tissue using the inductively coupled plasma mass spectrometry (ICP-MS). (H) Immunoblot analysis of glial <t>fibrillary</t> acidic protein <t>(GFAP)</t> in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (I) IF staining of GFAP (green) reveals reactive astrocytes around brain vessels, with CD31 (red) used to mark brain vessels. Scale bar: 10 μm. (J) IF staining of albumin (red) extravasation around brain vessels, with CD31 (green) used to mark brain vessels. Scale bar: 50 μm. Data are represented as the mean ± SD ( n = 5 for the rest of the in vivo experiments). ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001 compared with the control group. # P < 0.05, ## P < 0.01 and ### P < 0.001 compared between the two experiment groups.
    Glial Fibrillary Acidic Protein Gfap Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/80788s/GFAP+XP+Rabbit+mAb/pmc13031070-72-23-29
    Average 96 stars, based on 1 article reviews
    glial fibrillary acidic protein gfap antibody - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc rabbit anti gfap catalog 80788s cell signaling technology
    The BBB-reversible opening effects by Au-rGO in vivo . (A) Schematic representation of Au-rGO exposure and the Evans blue permeability test in vivo . (B) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at different doses. (C) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at a dose of 4 mg/kg body weight for various durations ( n = 3). (D) Vibratome sections of brain tissue stained with horseradish peroxidase from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for different time points ranging from 30 min to 7 days. (E) Immunoblot analysis of VE-cadherin and Claudin-5 in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (F) Top-to-bottom continuous brain sections from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 2 h. (G) Measurement of Au content as an indicator of Au-rGO retention in brain tissue using the inductively coupled plasma mass spectrometry (ICP-MS). (H) Immunoblot analysis of glial <t>fibrillary</t> acidic protein <t>(GFAP)</t> in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (I) IF staining of GFAP (green) reveals reactive astrocytes around brain vessels, with CD31 (red) used to mark brain vessels. Scale bar: 10 μm. (J) IF staining of albumin (red) extravasation around brain vessels, with CD31 (green) used to mark brain vessels. Scale bar: 50 μm. Data are represented as the mean ± SD ( n = 5 for the rest of the in vivo experiments). ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001 compared with the control group. # P < 0.05, ## P < 0.01 and ### P < 0.001 compared between the two experiment groups.
    Rabbit Anti Gfap Catalog 80788s Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/80788s/GFAP+XP+Rabbit+mAb/pmc12869260-163-35-39
    Average 96 stars, based on 1 article reviews
    rabbit anti gfap catalog 80788s cell signaling technology - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc antibodies against gfap
    The BBB-reversible opening effects by Au-rGO in vivo . (A) Schematic representation of Au-rGO exposure and the Evans blue permeability test in vivo . (B) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at different doses. (C) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at a dose of 4 mg/kg body weight for various durations ( n = 3). (D) Vibratome sections of brain tissue stained with horseradish peroxidase from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for different time points ranging from 30 min to 7 days. (E) Immunoblot analysis of VE-cadherin and Claudin-5 in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (F) Top-to-bottom continuous brain sections from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 2 h. (G) Measurement of Au content as an indicator of Au-rGO retention in brain tissue using the inductively coupled plasma mass spectrometry (ICP-MS). (H) Immunoblot analysis of glial <t>fibrillary</t> acidic protein <t>(GFAP)</t> in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (I) IF staining of GFAP (green) reveals reactive astrocytes around brain vessels, with CD31 (red) used to mark brain vessels. Scale bar: 10 μm. (J) IF staining of albumin (red) extravasation around brain vessels, with CD31 (green) used to mark brain vessels. Scale bar: 50 μm. Data are represented as the mean ± SD ( n = 5 for the rest of the in vivo experiments). ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001 compared with the control group. # P < 0.05, ## P < 0.01 and ### P < 0.001 compared between the two experiment groups.
    Antibodies Against Gfap, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/80788s/GFAP+XP+Rabbit+mAb/10__36721_slash_pjps__2026__39__4__reg__15008__1-126-11-16
    Average 96 stars, based on 1 article reviews
    antibodies against gfap - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc anti iba1
    The BBB-reversible opening effects by Au-rGO in vivo . (A) Schematic representation of Au-rGO exposure and the Evans blue permeability test in vivo . (B) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at different doses. (C) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at a dose of 4 mg/kg body weight for various durations ( n = 3). (D) Vibratome sections of brain tissue stained with horseradish peroxidase from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for different time points ranging from 30 min to 7 days. (E) Immunoblot analysis of VE-cadherin and Claudin-5 in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (F) Top-to-bottom continuous brain sections from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 2 h. (G) Measurement of Au content as an indicator of Au-rGO retention in brain tissue using the inductively coupled plasma mass spectrometry (ICP-MS). (H) Immunoblot analysis of glial <t>fibrillary</t> acidic protein <t>(GFAP)</t> in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (I) IF staining of GFAP (green) reveals reactive astrocytes around brain vessels, with CD31 (red) used to mark brain vessels. Scale bar: 10 μm. (J) IF staining of albumin (red) extravasation around brain vessels, with CD31 (green) used to mark brain vessels. Scale bar: 50 μm. Data are represented as the mean ± SD ( n = 5 for the rest of the in vivo experiments). ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001 compared with the control group. # P < 0.05, ## P < 0.01 and ### P < 0.001 compared between the two experiment groups.
    Anti Iba1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/80788s/GFAP+XP+Rabbit+mAb/pm41604013-97-24-25
    Average 96 stars, based on 1 article reviews
    anti iba1 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    Effects of exosomes derived from GABA-fed mice on hippocampus in aged mice. ( a ) Brain sections (dentate gyrus, DG) were incubated with primary antibody for anti-Iba1, anti-GFAP, anti-p21 and anti-β-galactosidase, and stained with Alexa Fluor 555. After staining with Vestashield mounting medium, the tissue samples were observed under a fluorescence microscope. A 50 μm scale bar is shown in the lower right corner of each photograph. ( b ) Number of Iba1 + cells per area and relative area of GFAP + cells, p21 + cells and SA-β-Gal + cells in DG, CA3 and CA1 are shown as bar graphs (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. Adult mice; # p < 0.05; ## p < 0.01; ### p < 0.001 vs. Aged (Ctrl-Exo) mice; data are represented as means ± SEM, n = 10). GABA: Gamma-aminobutyric acid.

    Journal: International Journal of Molecular Sciences

    Article Title: GABA-Induced Exosomes Improve Memory Impairment in Aged Mice

    doi: 10.3390/ijms27062519

    Figure Lengend Snippet: Effects of exosomes derived from GABA-fed mice on hippocampus in aged mice. ( a ) Brain sections (dentate gyrus, DG) were incubated with primary antibody for anti-Iba1, anti-GFAP, anti-p21 and anti-β-galactosidase, and stained with Alexa Fluor 555. After staining with Vestashield mounting medium, the tissue samples were observed under a fluorescence microscope. A 50 μm scale bar is shown in the lower right corner of each photograph. ( b ) Number of Iba1 + cells per area and relative area of GFAP + cells, p21 + cells and SA-β-Gal + cells in DG, CA3 and CA1 are shown as bar graphs (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. Adult mice; # p < 0.05; ## p < 0.01; ### p < 0.001 vs. Aged (Ctrl-Exo) mice; data are represented as means ± SEM, n = 10). GABA: Gamma-aminobutyric acid.

    Article Snippet: Brain sections were incubated with primary antibodies for anti-Iba1 (#17197, Cell Signaling Technology, Danvers, MA, USA), anti-GFAP (#80788, Cell Signaling Technology), anti-p21 (#2974, Cell Signaling Technology), and anti-β Galactosidase (15518-1-AP, Proteintech, Rosemont, IL, USA), and subsequently with secondary antibodies (Alexa Fluor 555 anti-rabbit IgG, Thermo Fischer Scientific) [ ].

    Techniques: Derivative Assay, Incubation, Staining, Fluorescence, Microscopy

    The BBB-reversible opening effects by Au-rGO in vivo . (A) Schematic representation of Au-rGO exposure and the Evans blue permeability test in vivo . (B) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at different doses. (C) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at a dose of 4 mg/kg body weight for various durations ( n = 3). (D) Vibratome sections of brain tissue stained with horseradish peroxidase from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for different time points ranging from 30 min to 7 days. (E) Immunoblot analysis of VE-cadherin and Claudin-5 in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (F) Top-to-bottom continuous brain sections from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 2 h. (G) Measurement of Au content as an indicator of Au-rGO retention in brain tissue using the inductively coupled plasma mass spectrometry (ICP-MS). (H) Immunoblot analysis of glial fibrillary acidic protein (GFAP) in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (I) IF staining of GFAP (green) reveals reactive astrocytes around brain vessels, with CD31 (red) used to mark brain vessels. Scale bar: 10 μm. (J) IF staining of albumin (red) extravasation around brain vessels, with CD31 (green) used to mark brain vessels. Scale bar: 50 μm. Data are represented as the mean ± SD ( n = 5 for the rest of the in vivo experiments). ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001 compared with the control group. # P < 0.05, ## P < 0.01 and ### P < 0.001 compared between the two experiment groups.

    Journal: Acta Pharmaceutica Sinica. B

    Article Title: Reversibly unlocking the blood–brain barrier: A study on microtubule dynamics modulation using gold nanoparticle-modified reduced graphene oxide

    doi: 10.1016/j.apsb.2025.12.015

    Figure Lengend Snippet: The BBB-reversible opening effects by Au-rGO in vivo . (A) Schematic representation of Au-rGO exposure and the Evans blue permeability test in vivo . (B) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at different doses. (C) Brain tissue staining with Evans blue from mice intravenously exposed to Au-rGO at a dose of 4 mg/kg body weight for various durations ( n = 3). (D) Vibratome sections of brain tissue stained with horseradish peroxidase from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for different time points ranging from 30 min to 7 days. (E) Immunoblot analysis of VE-cadherin and Claudin-5 in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (F) Top-to-bottom continuous brain sections from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 2 h. (G) Measurement of Au content as an indicator of Au-rGO retention in brain tissue using the inductively coupled plasma mass spectrometry (ICP-MS). (H) Immunoblot analysis of glial fibrillary acidic protein (GFAP) in brain tissue from mice exposed to Au-rGO at a dose of 4 mg/kg body weight for 1, 2, 6 h, 1 day, and 7 days. (I) IF staining of GFAP (green) reveals reactive astrocytes around brain vessels, with CD31 (red) used to mark brain vessels. Scale bar: 10 μm. (J) IF staining of albumin (red) extravasation around brain vessels, with CD31 (green) used to mark brain vessels. Scale bar: 50 μm. Data are represented as the mean ± SD ( n = 5 for the rest of the in vivo experiments). ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001 compared with the control group. # P < 0.05, ## P < 0.01 and ### P < 0.001 compared between the two experiment groups.

    Article Snippet: For brain immunofluorescence (IF) staining, CD31 antibody (Proteintech 11265-1-AP (rabbit), IL, USA; Huabio M1511-8 (mouse), Hangzhou, China) was used to mark brain vessels, glial fibrillary acidic protein (GFAP) antibody (Cell Signaling Technology 80788, MA, USA) was used to mark reactive astrocytes around brain vessels, and Albumin antibody (Proteintech 16475-1-AP, IL, USA) was used to mark Albumin extravasation around brain vessels.

    Techniques: In Vivo, Permeability, Staining, Western Blot, Clinical Proteomics, Mass Spectrometry, Control