Cell Signaling Technology Inc is a verified supplier
Cell Signaling Technology Inc manufactures this product
Structured Review
Cell Signaling Technology Inc
anti gfap
Anti Gfap, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 414 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and morehttps://www.bioz.com/product/80788s/GFAP+XP+Rabbit+mAb/pmc13026798-171-16-18
Average 96 stars, based on 414 article reviews
anti gfap - by
Bioz Stars,
2026-09
96/100 stars
Images
1) Product Images from "GABA-Induced Exosomes Improve Memory Impairment in Aged Mice"
Article Title: GABA-Induced Exosomes Improve Memory Impairment in Aged Mice
Journal: International Journal of Molecular Sciences
doi: 10.3390/ijms27062519
Figure Legend Snippet: Effects of exosomes derived from GABA-fed mice on hippocampus in aged mice. ( a ) Brain sections (dentate gyrus, DG) were incubated with primary antibody for anti-Iba1, anti-GFAP, anti-p21 and anti-β-galactosidase, and stained with Alexa Fluor 555. After staining with Vestashield mounting medium, the tissue samples were observed under a fluorescence microscope. A 50 μm scale bar is shown in the lower right corner of each photograph. ( b ) Number of Iba1 + cells per area and relative area of GFAP + cells, p21 + cells and SA-β-Gal + cells in DG, CA3 and CA1 are shown as bar graphs (* p < 0.05; ** p < 0.01; *** p < 0.001 vs. Adult mice; # p < 0.05; ## p < 0.01; ### p < 0.001 vs. Aged (Ctrl-Exo) mice; data are represented as means ± SEM, n = 10). GABA: Gamma-aminobutyric acid.
Techniques Used: Derivative Assay, Incubation, Staining, Fluorescence, Microscopy
Related Articles
other:
Recombinant:Article Title: NGPF2 triggers synaptic scaling up through ALK-LIMK-cofilin-mediated mechanisms.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse GluA2-NTD Millipore Cat#MAB397; RRID: AB_2113875 Rabbit NGPF2 Peprotech Cat#500-P171; RRID: AB_148164 Rabbit NGPF1 Proteintech Cat# 10821-1-AP, RRID: AB_11042879 Rabbit Cofilin CST Cat#5175; RRID: AB_10622000 Rabbit p-Cofilin Santa Cruz Cat#sc-12912-R; RRID: AB_673572 Rabbit p-LIMK1/p-LIMK2 Origene Cat#TA325621S Rabbit MAP2 Millipore Cat#MAB3418; RRID: AB_11212326 Rabbit FMRP CST Cat#4317S; RRID: AB_1903978 Rabbit Synapsin 1 CST Cat# 5297, RRID: AB_2616578 Rabbit ALK Abcam Cat#ab275964 Rabbit GFAP CST Cat80788S; RRID: AB_2799963 Rabbit NeuN Abcam Cat#ab177487; RRID: AB_2532109 Rabbit Actin Bioworld Cat#ap0060; RRID: AB_2797445 Rabbit LIMK1 CST Cat#3842S; RRID: AB_2281332 Rabbit ALDH1L1 Abcam Cat#ab177463; RRID: AB_2811300 Rabbit GluA1 CST Cat#13185; RRID: AB_2732897 Mouse beta-3-Tubulin CST Cat# 4466; RRID: AB_1904176 Rabbit p-ERK CST Cat# 4370; RRID: AB_2315112 Rabbit p-Akt (Ser473) CST Cat# 4060; RRID: AB_2315049 Rabbit p-Akt (Thr308) CST Cat# 13038, RRID: AB_2629447 Chemicals, peptides, and recombinant proteins Tetrodotoxin Alomone Labs Cat#T-550 Picrotoxin Sigma-Aldrich Cat#R284556 Bicuculline Sigma-Aldrich Cat#B7561 LDK Selleck Cat#S7083 ASP Selleck Cat#S8054 LIMKi-3 Sigma-Aldrich Cat#435930 Rhodamine Phalloidin Thermo-Fisher Cat#R415 DAPI Cayman Chemical Cat#28718-90-3 Poly-D-Lysine Sigma-Aldrich Cat#P7280 Diamond Antifade Mountant Thermo-Fisher Cat#P36965 GlutaMax Thermo-Fisher Cat#35050061 Neurobasal A Thermo-Fisher Cat#10888022 B27 Thermo-Fisher Cat#17504044 Penicillin-Streptomycin GIBCO Cat#15140122 Actinomycin D Selleck Cat#S8964 Anisomycin Selleck Cat#S7409 rNGPF2 protein This paper N/A Deposited data scRNA-Seq Data Bhattacherjee et al., 2019 GEO: GSE124952 scRNA-Seq Data Chu et al., 2019 GEO: GSE135326 RNA-seq Data This paper GEO:GSE179402 (Continued on next page) e1 Cell Reports 36, 109515, August 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines CHO cells SIBCB GNHa 7 Experimental models: organisms/strains C57BL/6 wildtype mice Charles River N/A LIMK1/2 double knockout mice Meng et al., 2002; Takahashi et al., 2002 N/A B6.129P2-Fmr1tm1Cgr/J Jackson Laboratory JAX: 003025 Oligonucleotides ASO1: GCTTAGTCACGCGGATGGTC This paper N/A ASO2: CTTGTATTTGCAGTCGGCTC This paper N/A ASO3: AAGGGCGAGAAGGAAGAAGC This paper N/A Recombinant DNA NGPF2/pIRES2-EGFP This paper N/A Software and algorithms pCLAMP 11 Molecular Device https://www.moleculardevices.com/ Mini Analysis Program 6.0.3 Synaptosoft Inc http://www.synaptosoft.com/ Zen 2010 software Zeiss https://www.zeiss.com/microscopy/ int/home.html ImageJ NIH https://imagej.nih.gov/ij/index.html
RNA Sequencing:Article Title: NGPF2 triggers synaptic scaling up through ALK-LIMK-cofilin-mediated mechanisms.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse GluA2-NTD Millipore Cat#MAB397; RRID: AB_2113875 Rabbit NGPF2 Peprotech Cat#500-P171; RRID: AB_148164 Rabbit NGPF1 Proteintech Cat# 10821-1-AP, RRID: AB_11042879 Rabbit Cofilin CST Cat#5175; RRID: AB_10622000 Rabbit p-Cofilin Santa Cruz Cat#sc-12912-R; RRID: AB_673572 Rabbit p-LIMK1/p-LIMK2 Origene Cat#TA325621S Rabbit MAP2 Millipore Cat#MAB3418; RRID: AB_11212326 Rabbit FMRP CST Cat#4317S; RRID: AB_1903978 Rabbit Synapsin 1 CST Cat# 5297, RRID: AB_2616578 Rabbit ALK Abcam Cat#ab275964 Rabbit GFAP CST Cat80788S; RRID: AB_2799963 Rabbit NeuN Abcam Cat#ab177487; RRID: AB_2532109 Rabbit Actin Bioworld Cat#ap0060; RRID: AB_2797445 Rabbit LIMK1 CST Cat#3842S; RRID: AB_2281332 Rabbit ALDH1L1 Abcam Cat#ab177463; RRID: AB_2811300 Rabbit GluA1 CST Cat#13185; RRID: AB_2732897 Mouse beta-3-Tubulin CST Cat# 4466; RRID: AB_1904176 Rabbit p-ERK CST Cat# 4370; RRID: AB_2315112 Rabbit p-Akt (Ser473) CST Cat# 4060; RRID: AB_2315049 Rabbit p-Akt (Thr308) CST Cat# 13038, RRID: AB_2629447 Chemicals, peptides, and recombinant proteins Tetrodotoxin Alomone Labs Cat#T-550 Picrotoxin Sigma-Aldrich Cat#R284556 Bicuculline Sigma-Aldrich Cat#B7561 LDK Selleck Cat#S7083 ASP Selleck Cat#S8054 LIMKi-3 Sigma-Aldrich Cat#435930 Rhodamine Phalloidin Thermo-Fisher Cat#R415 DAPI Cayman Chemical Cat#28718-90-3 Poly-D-Lysine Sigma-Aldrich Cat#P7280 Diamond Antifade Mountant Thermo-Fisher Cat#P36965 GlutaMax Thermo-Fisher Cat#35050061 Neurobasal A Thermo-Fisher Cat#10888022 B27 Thermo-Fisher Cat#17504044 Penicillin-Streptomycin GIBCO Cat#15140122 Actinomycin D Selleck Cat#S8964 Anisomycin Selleck Cat#S7409 rNGPF2 protein This paper N/A Deposited data scRNA-Seq Data Bhattacherjee et al., 2019 GEO: GSE124952 scRNA-Seq Data Chu et al., 2019 GEO: GSE135326 RNA-seq Data This paper GEO:GSE179402 (Continued on next page) e1 Cell Reports 36, 109515, August 17, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: cell lines CHO cells SIBCB GNHa 7 Experimental models: organisms/strains C57BL/6 wildtype mice Charles River N/A LIMK1/2 double knockout mice Meng et al., 2002; Takahashi et al., 2002 N/A B6.129P2-Fmr1tm1Cgr/J Jackson Laboratory JAX: 003025 Oligonucleotides ASO1: GCTTAGTCACGCGGATGGTC This paper N/A ASO2: CTTGTATTTGCAGTCGGCTC This paper N/A ASO3: AAGGGCGAGAAGGAAGAAGC This paper N/A Recombinant DNA NGPF2/pIRES2-EGFP This paper N/A Software and algorithms pCLAMP 11 Molecular Device https://www.moleculardevices.com/ Mini Analysis Program 6.0.3 Synaptosoft Inc http://www.synaptosoft.com/ Zen 2010 software Zeiss https://www.zeiss.com/microscopy/ int/home.html ImageJ NIH https://imagej.nih.gov/ij/index.html
|